Monday, May 25, 2020
Cloning and Expressing of Aryl Alcohol Oxidase - Free Essay Example
Sample details Pages: 3 Words: 862 Downloads: 6 Date added: 2019/08/08 Category Science Essay Level High school Tags: Cloning Essay Did you like this example? Abstract: Cellulose fuel ethanol does great significance on solving the energy crisis and reducing environment pollution. However, in the process of industrially degrading cellulose into ethanol, it is difficult to directly degrade the cellulose because of the presence of the lignin barrier. While the aryl alcohol oxidase is responsible for providing H2O2 to initiate the enzymatic reaction of lignin peroxiadase and manganese peroxidase in the lignin degradation system of white rot fungi. Donââ¬â¢t waste time! Our writers will create an original "Cloning and Expressing of Aryl Alcohol Oxidase" essay for you Create order In this study, we obtained the cDNA of aryl alcohol oxidase by obtaining the white fungi RNA and then carrying out reverse transcription method, and transforming it into Pichia pastoris for heterologous expression to collect aryl alcohol oxidase. Subsequent purification was performed for further use. Key Words: white rot fungi; aryl alcohol oxidase; Pichia pastoris Introduction Because of the decreasing of oil production and Greenhouse Effect, people turn to new energy while one of them is cellulose fuel ethanol. [1][2] However, several challenges occur during the catalytic process from cellulose to alcohol. One of the challenges is what we call ââ¬Å"lignin barrierâ⬠, which is a network around the cellulose composed of lignin and hemicellulose by covalent bond.[3] The existence of lignin barrier will hinder the contact between cellulose and its catalyst. Meanwhile, an enzyme system from white rot fungi which can degrade the lignin barrier efficiently has been reported.[3] This enzyme system contains several enzymes like laccase(Lac), manganese peroxidase(MnP), lignin peroxidase(LiP), aryl alcohol oxidase(AAO), etc.[3][4] The function of AAO is to provide H2O2 to start the reaction catalyzed by MnP or LiP.[5][6] One characteristic of AAO is that is can oxidize alcohol to aldehyde.[7] In our study, we cloned the gene of AAO and transformed it into Pich ia pastoris which is suitable host to express exogenous gene. Then we cultivate the yeast and detect the enzymatic activity every day. When the enzymatic activity peaked, we separated AAO from formented liquid and purified it by dialysis and anion exchange resin. We then calculated the output and enzymatic activity of our AAO and compared it with the nature one to find that whether the expression and enzymatic activity of exogenous AAO gene is remarkable to be used in industry or not. Results Obtain the AAO Gene Fig.1 Blast analysis of AAO gene we obtained. The first one is hypothesis so it is excluded. The second one is AAO gene and the similarity between is 98%. By inverse transcription and polymerase chain reaction (PCR) we can get the sequence of AAO. We can draw the conclusion the we successfully obtained the AAO genes using Blast analysis (Fig.1). Analysis of AAO cds Fig.2 Amino acid sequence of AAO cds.. Using Expasy to translate our AAO cds we can draw the amino acid sequence of AAO. Message we can gain from the amino acid sequence is that AAO is composed of 593 amino acids and its molecular weight is 63683.40. By analyzing its amino acid sequence we can learn more about its spatial structure and how it works. Enzymatic Activity Material and Methods Obtain the AAO Gene First, we had used the Trizol method to obtain all the RNA of Pleurotus ostreatus BP3, one kind of white rot fungi. The we degraded it by applying RNase and obtained the AAO RNA sequence by electrophoresis. After that the AAO DNA sequence was obtained by inverse transcription and was amplified by PCR. Formulation and Transformation of the Plasmid Carrier Fig.2 Anticipated formulation of plasmid carrier. AOX1 promoter only can be activated by methyl alcohol so we can control the start of AAO expression. CYC1 terminator is used to stop the expression. Before and after AAO sequence there are two restriction sites for EcoR 1 and Xba 1. We use pPICZ?A plasmid for our formulation. First, we use EcoR 1 and Xba 1 for a double-restriction on the plasmid. Then we can ligate AAO DNA sequence to both ends by a Vazyme kit during PCR. [8] The primer is designed as: HAAO-F? AGAGAGGCTGAAGCTGAATTCAACCTCCCAACCGCTGATTTTGATTA HAAO-R? GAGATGAGTTTTTGTTCTAGACTACTGATCAGCCTTAATAAGATCGGC After that the pPICZ?A-AAO plasmid was transformed into Pichia pastoris and was expressed as exogenous gene. Detection of Enzymatic Activity The enzymatic activity was calculated according to a reaction catalyzed by AAO from mannitol to mannuronate. The latter owns a absorption peak at 330 nm.[9] The absorption of this reaction system at 330nm is monitored by an ELIASA and according to its variation we can get a slope. The enzymatic activity should be inferred by this equation[9]: enzymatic activity?U/L?=(slopeÃâ"10^6 Ãâ"0.2 )/(9300 Ãâ"0.625 Ãâ"0.01 ) In this equation, 0.2 stands for the volume of reaction system (0.2ml), 9300 equals 9300M-1cm-1?, 0.625 means the optical path is 0.625cm and 0.01 is the volume of liquid which is used for ELIASA to detect. Discussion and Conclusion From the final enzymatic activity we can draw the conclusion that the output and enzymatic activity of exogenous AAO gene is similar to/better than nature white rot fungi.[10] For this reason, we can deem that our idea to express AAO in Pichia pastoris is feasible to be apply to industry in order to degrade the lignin barrier. That will directly lead to the progression of efficient to catalyze cellulose to alcohol. Acknowledgements This study is supported by my tutor Dr.Wang and my senior Miss.Gong.
Friday, May 15, 2020
Bulimia and Depression Essay - 2364 Words
Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimiaâ⬠¦show more contentâ⬠¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words à |à 5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words à |à 5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words à |à 4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words à |à 6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly ââ¬Å"low in caloriesâ⬠. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words à |à 6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ââ¬Ëserious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words à |à 5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a personsââ¬â¢ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words à |à 4 Pagespaper to examine how the events of Dianaââ¬â¢s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Todayââ¬â¢s World are Affected by Societyââ¬â¢s Projection of Self-image670 Words à |à 3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words à |à 5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people donââ¬â¢t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words à |à 5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than
Bulimia and Depression Essay - 2364 Words
Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimiaâ⬠¦show more contentâ⬠¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words à |à 5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words à |à 5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words à |à 4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words à |à 6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly ââ¬Å"low in caloriesâ⬠. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words à |à 6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ââ¬Ëserious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words à |à 5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a personsââ¬â¢ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words à |à 4 Pagespaper to examine how the events of Dianaââ¬â¢s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Todayââ¬â¢s World are Affected by Societyââ¬â¢s Projection of Self-image670 Words à |à 3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words à |à 5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people donââ¬â¢t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words à |à 5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than
Bulimia and Depression Essay - 2364 Words
Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimiaâ⬠¦show more contentâ⬠¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words à |à 5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words à |à 5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words à |à 4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words à |à 6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly ââ¬Å"low in caloriesâ⬠. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words à |à 6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ââ¬Ëserious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words à |à 5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a personsââ¬â¢ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words à |à 4 Pagespaper to examine how the events of Dianaââ¬â¢s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Todayââ¬â¢s World are Affected by Societyââ¬â¢s Projection of Self-image670 Words à |à 3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words à |à 5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people donââ¬â¢t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words à |à 5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than
Bulimia and Depression Essay - 2364 Words
Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimiaâ⬠¦show more contentâ⬠¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words à |à 5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words à |à 5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words à |à 4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words à |à 6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly ââ¬Å"low in caloriesâ⬠. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words à |à 6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ââ¬Ëserious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words à |à 5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a personsââ¬â¢ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words à |à 4 Pagespaper to examine how the events of Dianaââ¬â¢s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Todayââ¬â¢s World are Affected by Societyââ¬â¢s Projection of Self-image670 Words à |à 3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words à |à 5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people donââ¬â¢t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words à |à 5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than
Wednesday, May 6, 2020
Descriptive Essay - Original Writing - 899 Words
My hands knuckles were turning white as I gripped the steering wheel. I tried to calm my breathing a little bit because I swear I was on the verge of hyperventilating. ââ¬Å"Well, if you donââ¬â¢t pass your drivers test youââ¬â¢ll have to walk to work tomorrow,â⬠instead of helping lighten the mood, my dad made it worse by pissing me off. ââ¬Å"Well, then I guess I just wonââ¬â¢t show up at work.â⬠ââ¬Å"Well then I guess you wonââ¬â¢t have to take your driver s test because I wonââ¬â¢t let you drive,â⬠he instantly snapped back into his normal sturn self. I always hated how he thought he could make snide remarks to me, but the second I tried to banter back, he would switch back into strict dad mode. We pulled up to the DMV and my grip on the steering wheel grew even tighter. We went inside and registered. The lady at the desk shot me a smile, but in her eyes I could tell that she secretly hoped that I would fail I bet she enjoys when kids fail. She probably gets happy when kids come in with tears in their eyes because they wonââ¬â¢t be able to do donuts in the parking lot after school. ââ¬Å" Okay, here is a checklist to go over. Go sit in your car and wait for the driving instructor,â⬠she sounded like she was reading straight from a index card. I got in my car and slumped over in my seat. ââ¬Å"Why am I this nervous? This wonââ¬â¢t even be hard. Just drive slow and youââ¬â¢ll be okay. Donââ¬â¢t hit the brakes to hard and look over your shoulder.â⬠Any person walking by probably thought I was strange for talking to myself, but itShow MoreRelatedDescriptive Essay - Original Writing1110 Words à |à 5 PagesI donââ¬â¢t know how I got to where I am, but Iââ¬â¢m here now, and I have to win if I want to live. I am in a game, and in order to live, I have to escape. Thatââ¬â¢s the thing, though: I donââ¬â¢t know how to escape. I was running for my life around this old house that looked like it came straight out of a horror movie. I doubled over and held my head in pain as I saw the static, which meant it was coming. I was being chased by what looked like a person but in no way acted like one. Just as it was about to appearRead MoreDescriptive Essay - Original Writing1102 Words à |à 5 PagesIt is on da ys like this when we stop to think about our life. Small drops of rain begin to dapple the cobblestone pavement as people whip out their umbrellas for cover. I continue sauntering down the busy street, relishing the feeling of a light shower. Moving with the mass of pedestrians, I stop at a crosswalk where I wait for the stoplight to turn green. A flower shop employee across the street scurries to bring in the numerous bouquets and close the doors as rain starts rolling down the displayRead MoreDescriptive Essay - Original Writing914 Words à |à 4 PagesDreamy I thought. Standing on the corner is a young guy with a smile. I see him here almost every day, so I linger for a while. He tells me his name, and I tell him mine. I m Ester, what s your name? I enquired. My names David .,He replied. We end up talking for a while and I asked him if he had ever left this city. He tells me of all these stories of the places where he s been, the distant lakes and mountains, and in valleys oh so green. I can see it in his eyes, he really has beenRead MoreDescriptive Essay - Original Writing974 Words à |à 4 Pages I was used to moving round, having a mother who liked to travel more than making roots was something I had gotten used to. Still, I had never gotten used to the loneliness of an empty house when she was out exploring, or the feeling of leaving behind someone who could have meant something to me. Our most recent move was Oregon. It was pretty, and I didnââ¬â¢t mind it, but it was much different than Florida. Not only was it opposite sides of the country, it felt as if it were opposite worlds. InRead MoreDescriptive Essay - Original Writing1012 Words à |à 5 Pageshave plenty of time in the next month to think about my feeling in regards to Kendrick. I needed to finish up the article and get it off to my editor. I should be able to get it done by tonight and send an email in the morning. I was thinking of writing my next article about the sea life around the Scottish coast. Since our salmon dinner last evening I thought I would do a piece about the commercial salmon farming that began in Scotland in 1969. In 2002 over 145,000 metric tons of farmed AtlanticRead MoreDescriptive Essay - Original Writing1561 Words à |à 7 PagesThereââ¬â¢s something I need to say and what follows may not be something that youââ¬â¢d expect, it wonââ¬â¢t be heartening or uplifting. If you remember today, I told you about going somewhere I wanted to go toâ⬠¦ Iââ¬â¢m not sure if you believed and accepted what I now confess as untrue; it is partly. I needed to pull away emo tionallyâ⬠¦ from you. You must have had fathomed that some degree of formality had seeped between us. Born of habit, formulaic greetings had become a routine. You presume that Iââ¬â¢m a close friendRead MoreDescriptive Essay - Original Writing1387 Words à |à 6 PagesI was wearing a beautiful blue dress with sapphire gems all around the chest area as I entered the ball with Ciel and Sebastian. I took a good look around here, the hallway was lined with gold. There was a servant ready to escort us to the ball room. Hello, come this way. He said, walking forward. Wow, this place is so fancy! I exclaimed, looking around. It s fake gold. Ciel bluntly replied, bringing my hopes down. I sighed. Ciel sounded like he wasn t in a very good mood. Ciel, lightenRead MoreDescriptive Essay - Original Writing1287 Words à |à 6 Pages In the morning, Caireann woke me up. She stood above my bed, shaking my shoulder. I opened my eyes, looking at her. Then I looked across the room to her empty bed. Andy s empty bed sat in the corner. I swallowed, climbing out of bed. Sleep well? Caireann asked me, starting out the door. Yeah, I said, going over to our small dresser. I had the bottom two drawers. Andy had the middle two, and Caireann had the top. I pulled open the drawers, pulling on a colorful tank top and a grayRead MoreDescriptive Essay - Original Writing1345 Words à |à 6 PagesLater that night, I was behind the wheel of my G-Wagon with Melissa in the passenger seat. She didnââ¬â¢t feel like driving since she was on the road all day and I understood so I didnââ¬â¢t mind when she asked me to. I had been tight-lipped. She kept eyeballing me as if she detected that something was bothering me but I just kept singing to my India Arie as if I was carefree. ââ¬Å"So are you going to tell me whatââ¬â¢s going on or noâ⬠Melissa said disrupting my own personal concert. I stopped singing and tookRead MoreDescriptive Essay - Original Writing1085 Words à |à 5 PagesI WAS SITTING IN a taxi, wondering if I had overdressed for the evening, when I looked out the window and saw Mom rooting through a Dumpster. It was just after dark. A blustery March wind whipped the steam coming out of the manholes, and people hurried along the sidewalks with their collars turned up. I was stuck in traffic two blocks from the party where I was heading. Mom stood fifteen feet away. She had tied rags around her shoulders to keep out the spring chill and was picking through the trash
Tuesday, May 5, 2020
Business Model for Purpose and Organizational Goal - myassignmenthelp
Question: Write about theBusiness Model for Purpose and Organizational Goal. Answer: Business model can be defined as the conceptual structure that helps the organization to achieve its mission, purpose and organizational goal. Business models are designed in order to create the value and distribute it in a profitable way. The business models acts in between the two poles of classification and taxonomy (Baden-Fuller Morgan, 2010). Zott and Amit oppose the idea of a general business model, as each business works in a very different individual way. The business models classificatory function depends on the scale models and short-hand definitions (Zott Amit, 2010). In an effective business model the role model and scale model come together and the internet based Google business model is one such example. The concept of business model is getting huge attention because of the internet revolution. Many scholars use the term in order to define as how the internet transformed the traditional business models (Laudon Traver, 2013). The emergence of e-commerce has motivated the scholars and business professionals examine the business models of their organizations. Figure: Business Model Formation ( Source: Made by author) A coherent framework is achieved through the business model which helps the organization to gain financial output. Therefore business model can be described as an abstract model that connects business processes and strategies. Organizations often confuse business model with revenue model (DaSilva Trkman, 2014). Revenue model is a part of the business model which only describes the volume of the revenue, its sources and distribution. Carl Jung developed the idea of business model archetype. He describes archetypes is something which possess certain qualities that others follow and inherit to develop their own. There are business models with fundamental business qualities that provides others good structural base for effective business (Zott, Amit, 2010). The electronic communication has changed the business model significantly. The information technology is at the core of e commerce. Before the emergence of e-commerce the organizations could not maintain close relationship with suppliers as the system was stand alone and high cost based. The e commerce technologies provided huge capabilities to the companies with connectivity, interactivity, openness and transparency which led the company in direct exchange of information among organizations (Barney Ray, 2015). The supplier integration resulted in customer satisfaction and influenced the business model overall. Many enterprises utilized the e commerce opportunity to develop new business models. Through innovate new business models the companies put substantial efforts in generate high revenue. The new business model helps them to improve the product and service quality; however the innovation of new business model requires ample time, research and huge investment. A survey by EIU or Economist Intelligence unit highlights that Majority of the companies now prefer innovative business models over new service or products (Bashir Verma, 2017). They believe that the new model is more effective than the others to give the company more competitive advantages. Another survey by IBM also demonstrated that the companies that went ahead in the competitive race than their competitors in last few years had concentrated more on developing their business models. The business model has four aspects of customer segment, management infrastructure, value proposition and financial aspects. There are other nine aspects that are interlinked with the four mention aspects that contribute to the structure of business model. Few of the important blocks can be identified as revenue streams, key activities and resources and customer relationships. Adapting anew value network model could be helpful to renovate the business model of the company (Stabell Fjeldstad, 1998). The company who has been adapting a new business model at an early stage utilizes the First mover advantages (Markide Sosa, 2013). The late adapters will create competitive resistance for the other company but the adapted business model will help them to overcome that and gain advantage of better sustainability as a first mover. According to Porter the two most adapted strategies to deal with the low cost competitors challenges are differentiation based business model and focus based business model. The differentiation based business model puts a lot of stress on new technologies to fulfill the customers growing need. By adapting the latest technology this business model helps them to connect with other businesses and customers all over the world. This way differentiation based business model helps them to gain the consumer surplus or the maximum value (Williamson, 2010). Focus based business model on the other hand only focuses on a specific niche market. This model practices a safe financial practice where interested customers pay premium value. However cost innovation has become a threat for both these business models. The competitors are offering high technological services at a low price and others are providing niche products to mass market. Larry Page and Sergey Brin founded search engine has grown to be more than just search engine that also deals with desktop applications, social networking, operating system mobiles, and other online services (Google.com, 2017). Goggle is a successful business model which generates billions every year. Googles business model is very creative and effective in a sense that the every customers various needs satisfied by various services of Google. There are niche customers who pay premium cost for special services like advanced mail service, cloud services and Google earth features. On the other hand Google offers lot of free services to its customers including search engine, map that holds a stable customer base for the company. A lot of advertisements are offered by the company to diverse range of customers so business partners invest on the company to attract more customers. Goggle gets in agreement with the mobile OEMs to let the customers downloading their apps. Then the company is also engaging in a lot of offline activities like smart glasses to humanoid robots. Google is a company primarily based on advanced technology. Everyday that is incorporating newer technologies to improve their business model. In a way the polyhedral business model of goggle is working with great success (Retolaza, San-Jose Ruz-Roquei, 2016). Therefore the value propositions practiced by the company are two types. Googles one value proposition is for webmasters who can monetize their services and earn money from the Google provided platform like Ad sense. The other value proposition is for the direct advertisers. Goggles business model has pioneered in successfully interpreting big data in every day practice. The company utilizes the big data from Webindex to equal the queries with desired results (Zicari, 2014). Their monetized platform working on capturing the data from the consumers as they use the search engine. Googles data driven business model in this way is ensuring maximum profit for the company. Various business models have been adapted by many companies; some of them are implementing innovative strategies in the business models. Most of them are well planned and executed and offering great outcomes. The changes in the technology have driven the changes in the models so more technological advancements will keep transforming the business models in future. Reference Baden-Fuller, C., Morgan, M. S. (2010). Business models as models.Long range planning,43(2), 156-171. Barney, J. Ray, Gautam. (2015). How information technology resources can provide a competitive advantage in customer service.Planning for Information Systems,3(2), pp.444-460. Bashir, M., Verma, R. (2017). Why Business Model Innovation Is the New Competitive Advantage.IUP Journal of Business Strategy,14(1), 7. Coleman, A. (2016).Is Google's model of the creative workplace the future of the office?.the Guardian. Retrieved 27 August 2017, from https://www.theguardian.com/careers/2016/feb/11/is-googles-model-of-the-creative-workplace-the-future-of-the-office DaSilva, C. M., Trkman, P. (2014). Business model: what it is and what it is not.Long range planning,47(6), 379-389. Laudon, K. C., Traver, C. G. (2013).E-commerce. Pearson. Markides, C., Sosa, L. (2013). Pioneering and first mover advantages: the importance of business models.Long Range Planning,46(4), 325-334. Our Products | Google. (2017).Google.com. Retrieved 27 August 2017, from https://www.google.com/intl/en/about/products/ Retolaza, J. L., San-Jose, L., Ruz-Roquei, M. (2016). Polyhedral Model: Social Value Model for Stakeholders. InSocial Accounting for Sustainability(pp. 37-51). Springer International Publishing. Stabell, C. B., Fjeldstad, . D. (1998). Configuring value for competitive advantage: on chains, shops, and networks.Strategic management journal, 413-437. Williamson, P. J. (2010). Cost innovation: preparing for a value-for-moneyrevolution.Long Range Planning,43(2), 343-353. Zicari, R. V. (2014). Big data: Challenges and opportunities.Big data computing,564. Zott, C., Amit, R. (2010). Business model design: an activity system perspective.Long range planning,43(2), 216-226.
Subscribe to:
Posts (Atom)