Gender Representation Essay

How cliché are the portrayals of Gender in my picked messages? My picked writings are ‘The Inbetweeners’ , ‘X Factor’ and ‘BBC News’. Each of the three writings speak to sex in various manners yet I wouldnt state that any of them genuinely speak to the two sexual orientations in cliché ways. In ‘The Inbetweeners’ the primary characters are depicted in a cliché route from the outset, they are boystrous and externalize ladies in the rough manner by which they talk about them. However when you look further into their characters you understand that they are not run of the mill by any means. The females in the show are run of the mill it might be said that they are entirely, sharp looking and are simply there for the â€Å"male gaze.† It is this male look that eventually makes them more impressive than the guys in the arrangement as they have the ability to either lay down with, or not lay down with the guys which removes all control from the men which is definitely not a common characteristic. At the point when you think about a run of the mill male in television they are solid, attractive and in charge, this isn't generally clear in ‘The Inbetweeners’ which underpins the manliness in emergency hypothesis which expresses that guys are not, at this point the prevailing sex in current society. Ladies might be externalized still yet they utilize their sex request to there advantage and get their own particular manner leaving the guys feeble. You do how ever have the regular character of Jays father which is a hyperbolic case of a male as he passes gas, swears and acts in a totally innaproriate path for the comedic esteem. The ‘X Factor’ has an exceptionally differentiating portrayal of sexual orientation. In one manner the male characters are cliché as they have the ability to state yes or no to the goes about as judges. Guys are characteristically known for being in a place of intensity so this is an ordinary portrayal. However you have Dermot O’leary who is extremely manly in his appearance yet is exceptionally thinking about the challengers. This isn't common as guys arent normally appeared to have a mindful side or feelings as that is left for the ladies. This again bolsters the hypothesis of manliness in emergency. The Female Judges don't have an extremely run of the mill portrayal. They are in a place of power and power and to a degree in the new arrangement do have more force than the male appointed authorities as they are increasingly commanding and show signs of improvement. This isn't commonly the manner in which ladies are spoken to fitting into the hypothesis of Masculinity in emergency. The BBC news is a lot of like the ‘X Factor’. At the point when the guys are the stays they are in a place of intensity and information which is a normal portrayal. They appear to the country as a mainstay of information and the open give them a tremendous measure of regard which is normal of the portrayal of men. At the point when the ladies are grapples they also are viewed as a mainstay of information and are given a similar regard which doesn't fit into the run of the mill portrayal of a female.

No Such Thing - John Mayer Song free essay sample

John Mayer rouses individuals who don’t have it in the same class as a portion of the individuals around them to take a gander at things in an unexpected way. He conveys a message saying that its alright to appear as something else and not every person will wind up as effective as each other. It is significant not to contrast yourself with any other person and not feel that you need to satisfy what individuals need u to. Things you do ought to be done in light of the fact that you need it, and not to fulfill another person. There are numerous things out in the â€Å"real world†. Something there to fulfill everybody, except you need to go out and search for things, they won't discover you. Things happen to individuals at various occasions, and you should feel frustrated about yourself, or terrible about yourself since it may appear that they have it superior to you. Simply tuning in to John Mayer, particularly â€Å"No Such Thing† he is marvelous. We will compose a custom article test on Nothing of the sort John Mayer Song or on the other hand any comparative theme explicitly for you Don't WasteYour Time Recruit WRITER Just 13.90/page John Mayer is another stone craftsman. He is a lyricist and vocalist. He is an invigorating change from most popular music heard today. John Mayer sings about how he feels, where as other craftsman sing what the person feels the individuals need to feel, thus, it doesn't seem like it is originating from the heart. John has a pleasant acoustic tune and sings awesome music that state, from multiple points of view, â€Å"Ill show them†. The verses in his melodies are so important. I like the verses to â€Å"No Such Thing† by John Mayer so much since I can identify with him to such an extent. At the point when Mayer sings â€Å"They need to let you know, remain inside the lines yet a few things better on the other side†, he is stating that individuals should take risks. It implies that you don’t consistently need to make the best decision and you ought to go out into this present reality, open up to new chances, and face reality

Essay Samples For BSN

Essay Samples For BSNGetting the right essay samples for BSN can be a challenge. In fact, sometimes we end up getting too many and it feels like we are wasting our time trying to find the right one. Well, you shouldn't have this problem.Having to write an essay in order to get into a BSN program can be overwhelming. So many things need to go right and unfortunately for some, the writing has to go wrong in order for them to achieve this. If you happen to find yourself in this position, try looking for essay samples for BSN. They will help you along the way.One of the best ways to get essay samples for BSN is to look for them in your classes. Most professors require this in their students and if not, they will likely have the class read it to them so that they can correct any mistakes. You may even be able to get this in your classes without your professor reading it. This is another reason why you should write a rough draft first before sending it in.Another thing you can do to get es say samples for BSN is to ask for them. Your professor or other students in your class could have written them and it would be great to see them all together instead of just one copy.You may also find essay samples for BSN online. There are websites that have different types of essays for different situations. Some of them may be difficult to understand and not as readable as others. The good thing about these is that they may give you something to practice on if you find your essay to be a little difficult.There are some free sites online that will offer you essay samples for BSN. This is especially helpful when it comes to essay writing because they are free. While you won't be able to get any helpful information from them, it will allow you to write your own essays and maybe start fresh.In conclusion, it will take you a while to find essay samples for BSN. You should make sure you check online for a number of essays before you submit yours. You should also find a few places to ge t sample essays in your class so that you can practice with them.Don't worry if you cannot find any essay samples for BSN. Just keep trying until you find one that you can write well.

Cloning and Expressing of Aryl Alcohol Oxidase - Free Essay Example

Sample details Pages: 3 Words: 862 Downloads: 6 Date added: 2019/08/08 Category Science Essay Level High school Tags: Cloning Essay Did you like this example? Abstract: Cellulose fuel ethanol does great significance on solving the energy crisis and reducing environment pollution. However, in the process of industrially degrading cellulose into ethanol, it is difficult to directly degrade the cellulose because of the presence of the lignin barrier. While the aryl alcohol oxidase is responsible for providing H2O2 to initiate the enzymatic reaction of lignin peroxiadase and manganese peroxidase in the lignin degradation system of white rot fungi. Don’t waste time! Our writers will create an original "Cloning and Expressing of Aryl Alcohol Oxidase" essay for you Create order In this study, we obtained the cDNA of aryl alcohol oxidase by obtaining the white fungi RNA and then carrying out reverse transcription method, and transforming it into Pichia pastoris for heterologous expression to collect aryl alcohol oxidase. Subsequent purification was performed for further use. Key Words: white rot fungi; aryl alcohol oxidase; Pichia pastoris Introduction Because of the decreasing of oil production and Greenhouse Effect, people turn to new energy while one of them is cellulose fuel ethanol. [1][2] However, several challenges occur during the catalytic process from cellulose to alcohol. One of the challenges is what we call â€Å"lignin barrier†, which is a network around the cellulose composed of lignin and hemicellulose by covalent bond.[3] The existence of lignin barrier will hinder the contact between cellulose and its catalyst. Meanwhile, an enzyme system from white rot fungi which can degrade the lignin barrier efficiently has been reported.[3] This enzyme system contains several enzymes like laccase(Lac), manganese peroxidase(MnP), lignin peroxidase(LiP), aryl alcohol oxidase(AAO), etc.[3][4] The function of AAO is to provide H2O2 to start the reaction catalyzed by MnP or LiP.[5][6] One characteristic of AAO is that is can oxidize alcohol to aldehyde.[7] In our study, we cloned the gene of AAO and transformed it into Pich ia pastoris which is suitable host to express exogenous gene. Then we cultivate the yeast and detect the enzymatic activity every day. When the enzymatic activity peaked, we separated AAO from formented liquid and purified it by dialysis and anion exchange resin. We then calculated the output and enzymatic activity of our AAO and compared it with the nature one to find that whether the expression and enzymatic activity of exogenous AAO gene is remarkable to be used in industry or not. Results Obtain the AAO Gene Fig.1 Blast analysis of AAO gene we obtained. The first one is hypothesis so it is excluded. The second one is AAO gene and the similarity between is 98%. By inverse transcription and polymerase chain reaction (PCR) we can get the sequence of AAO. We can draw the conclusion the we successfully obtained the AAO genes using Blast analysis (Fig.1). Analysis of AAO cds Fig.2 Amino acid sequence of AAO cds.. Using Expasy to translate our AAO cds we can draw the amino acid sequence of AAO. Message we can gain from the amino acid sequence is that AAO is composed of 593 amino acids and its molecular weight is 63683.40. By analyzing its amino acid sequence we can learn more about its spatial structure and how it works. Enzymatic Activity Material and Methods Obtain the AAO Gene First, we had used the Trizol method to obtain all the RNA of Pleurotus ostreatus BP3, one kind of white rot fungi. The we degraded it by applying RNase and obtained the AAO RNA sequence by electrophoresis. After that the AAO DNA sequence was obtained by inverse transcription and was amplified by PCR. Formulation and Transformation of the Plasmid Carrier Fig.2 Anticipated formulation of plasmid carrier. AOX1 promoter only can be activated by methyl alcohol so we can control the start of AAO expression. CYC1 terminator is used to stop the expression. Before and after AAO sequence there are two restriction sites for EcoR 1 and Xba 1. We use pPICZ?A plasmid for our formulation. First, we use EcoR 1 and Xba 1 for a double-restriction on the plasmid. Then we can ligate AAO DNA sequence to both ends by a Vazyme kit during PCR. [8] The primer is designed as: HAAO-F? AGAGAGGCTGAAGCTGAATTCAACCTCCCAACCGCTGATTTTGATTA HAAO-R? GAGATGAGTTTTTGTTCTAGACTACTGATCAGCCTTAATAAGATCGGC After that the pPICZ?A-AAO plasmid was transformed into Pichia pastoris and was expressed as exogenous gene. Detection of Enzymatic Activity The enzymatic activity was calculated according to a reaction catalyzed by AAO from mannitol to mannuronate. The latter owns a absorption peak at 330 nm.[9] The absorption of this reaction system at 330nm is monitored by an ELIASA and according to its variation we can get a slope. The enzymatic activity should be inferred by this equation[9]: enzymatic activity?U/L?=(slopeÃâ€"10^6 Ãâ€"0.2 )/(9300 Ãâ€"0.625 Ãâ€"0.01 ) In this equation, 0.2 stands for the volume of reaction system (0.2ml), 9300 equals 9300M-1cm-1?, 0.625 means the optical path is 0.625cm and 0.01 is the volume of liquid which is used for ELIASA to detect. Discussion and Conclusion From the final enzymatic activity we can draw the conclusion that the output and enzymatic activity of exogenous AAO gene is similar to/better than nature white rot fungi.[10] For this reason, we can deem that our idea to express AAO in Pichia pastoris is feasible to be apply to industry in order to degrade the lignin barrier. That will directly lead to the progression of efficient to catalyze cellulose to alcohol. Acknowledgements This study is supported by my tutor Dr.Wang and my senior Miss.Gong.

Bulimia and Depression Essay - 2364 Words

Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimia†¦show more content†¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words   |  5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words   |  5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words   |  4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words   |  6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly â€Å"low in calories†. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words   |  6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ‘serious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words   |  5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a persons’ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words   |  4 Pagespaper to examine how the events of Diana’s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Today’s World are Affected by Society’s Projection of Self-image670 Words   |  3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words   |  5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people don’t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words   |  5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than

Bulimia and Depression Essay - 2364 Words

Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimia†¦show more content†¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words   |  5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words   |  5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words   |  4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words   |  6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly â€Å"low in calories†. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words   |  6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ‘serious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words   |  5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a persons’ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words   |  4 Pagespaper to examine how the events of Diana’s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Today’s World are Affected by Society’s Projection of Self-image670 Words   |  3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words   |  5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people don’t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words   |  5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than

Bulimia and Depression Essay - 2364 Words

Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimia†¦show more content†¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words   |  5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words   |  5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words   |  4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words   |  6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly â€Å"low in calories†. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words   |  6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ‘serious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words   |  5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a persons’ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words   |  4 Pagespaper to examine how the events of Diana’s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Today’s World are Affected by Society’s Projection of Self-image670 Words   |  3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words   |  5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people don’t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words   |  5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than

Bulimia and Depression Essay - 2364 Words

Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimia†¦show more content†¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words   |  5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words   |  5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words   |  4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words   |  6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly â€Å"low in calories†. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words   |  6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ‘serious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words   |  5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a persons’ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words   |  4 Pagespaper to examine how the events of Diana’s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Today’s World are Affected by Society’s Projection of Self-image670 Words   |  3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words   |  5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people don’t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words   |  5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than

Descriptive Essay - Original Writing - 899 Words

My hands knuckles were turning white as I gripped the steering wheel. I tried to calm my breathing a little bit because I swear I was on the verge of hyperventilating. â€Å"Well, if you don’t pass your drivers test you’ll have to walk to work tomorrow,† instead of helping lighten the mood, my dad made it worse by pissing me off. â€Å"Well, then I guess I just won’t show up at work.† â€Å"Well then I guess you won’t have to take your driver s test because I won’t let you drive,† he instantly snapped back into his normal sturn self. I always hated how he thought he could make snide remarks to me, but the second I tried to banter back, he would switch back into strict dad mode. We pulled up to the DMV and my grip on the steering wheel grew even tighter. We went inside and registered. The lady at the desk shot me a smile, but in her eyes I could tell that she secretly hoped that I would fail I bet she enjoys when kids fail. She probably gets happy when kids come in with tears in their eyes because they won’t be able to do donuts in the parking lot after school. â€Å" Okay, here is a checklist to go over. Go sit in your car and wait for the driving instructor,† she sounded like she was reading straight from a index card. I got in my car and slumped over in my seat. â€Å"Why am I this nervous? This won’t even be hard. Just drive slow and you’ll be okay. Don’t hit the brakes to hard and look over your shoulder.† Any person walking by probably thought I was strange for talking to myself, but itShow MoreRelatedDescriptive Essay - Original Writing1110 Words   |  5 PagesI don’t know how I got to where I am, but I’m here now, and I have to win if I want to live. I am in a game, and in order to live, I have to escape. That’s the thing, though: I don’t know how to escape. I was running for my life around this old house that looked like it came straight out of a horror movie. I doubled over and held my head in pain as I saw the static, which meant it was coming. I was being chased by what looked like a person but in no way acted like one. Just as it was about to appearRead MoreDescriptive Essay - Original Writing1102 Words   |  5 PagesIt is on da ys like this when we stop to think about our life. Small drops of rain begin to dapple the cobblestone pavement as people whip out their umbrellas for cover. I continue sauntering down the busy street, relishing the feeling of a light shower. Moving with the mass of pedestrians, I stop at a crosswalk where I wait for the stoplight to turn green. A flower shop employee across the street scurries to bring in the numerous bouquets and close the doors as rain starts rolling down the displayRead MoreDescriptive Essay - Original Writing914 Words   |  4 PagesDreamy I thought. Standing on the corner is a young guy with a smile. I see him here almost every day, so I linger for a while. He tells me his name, and I tell him mine. I m Ester, what s your name? I enquired. My names David .,He replied. We end up talking for a while and I asked him if he had ever left this city. He tells me of all these stories of the places where he s been, the distant lakes and mountains, and in valleys oh so green. I can see it in his eyes, he really has beenRead MoreDescriptive Essay - Original Writing974 Words   |  4 Pages I was used to moving round, having a mother who liked to travel more than making roots was something I had gotten used to. Still, I had never gotten used to the loneliness of an empty house when she was out exploring, or the feeling of leaving behind someone who could have meant something to me. Our most recent move was Oregon. It was pretty, and I didn’t mind it, but it was much different than Florida. Not only was it opposite sides of the country, it felt as if it were opposite worlds. InRead MoreDescriptive Essay - Original Writing1012 Words   |  5 Pageshave plenty of time in the next month to think about my feeling in regards to Kendrick. I needed to finish up the article and get it off to my editor. I should be able to get it done by tonight and send an email in the morning. I was thinking of writing my next article about the sea life around the Scottish coast. Since our salmon dinner last evening I thought I would do a piece about the commercial salmon farming that began in Scotland in 1969. In 2002 over 145,000 metric tons of farmed AtlanticRead MoreDescriptive Essay - Original Writing1561 Words   |  7 PagesThere’s something I need to say and what follows may not be something that you’d expect, it won’t be heartening or uplifting. If you remember today, I told you about going somewhere I wanted to go to†¦ I’m not sure if you believed and accepted what I now confess as untrue; it is partly. I needed to pull away emo tionally†¦ from you. You must have had fathomed that some degree of formality had seeped between us. Born of habit, formulaic greetings had become a routine. You presume that I’m a close friendRead MoreDescriptive Essay - Original Writing1387 Words   |  6 PagesI was wearing a beautiful blue dress with sapphire gems all around the chest area as I entered the ball with Ciel and Sebastian. I took a good look around here, the hallway was lined with gold. There was a servant ready to escort us to the ball room. Hello, come this way. He said, walking forward. Wow, this place is so fancy! I exclaimed, looking around. It s fake gold. Ciel bluntly replied, bringing my hopes down. I sighed. Ciel sounded like he wasn t in a very good mood. Ciel, lightenRead MoreDescriptive Essay - Original Writing1287 Words   |  6 Pages In the morning, Caireann woke me up. She stood above my bed, shaking my shoulder. I opened my eyes, looking at her. Then I looked across the room to her empty bed. Andy s empty bed sat in the corner. I swallowed, climbing out of bed. Sleep well? Caireann asked me, starting out the door. Yeah, I said, going over to our small dresser. I had the bottom two drawers. Andy had the middle two, and Caireann had the top. I pulled open the drawers, pulling on a colorful tank top and a grayRead MoreDescriptive Essay - Original Writing1345 Words   |  6 PagesLater that night, I was behind the wheel of my G-Wagon with Melissa in the passenger seat. She didn’t feel like driving since she was on the road all day and I understood so I didn’t mind when she asked me to. I had been tight-lipped. She kept eyeballing me as if she detected that something was bothering me but I just kept singing to my India Arie as if I was carefree. â€Å"So are you going to tell me what’s going on or no† Melissa said disrupting my own personal concert. I stopped singing and tookRead MoreDescriptive Essay - Original Writing1085 Words   |  5 PagesI WAS SITTING IN a taxi, wondering if I had overdressed for the evening, when I looked out the window and saw Mom rooting through a Dumpster. It was just after dark. A blustery March wind whipped the steam coming out of the manholes, and people hurried along the sidewalks with their collars turned up. I was stuck in traffic two blocks from the party where I was heading. Mom stood fifteen feet away. She had tied rags around her shoulders to keep out the spring chill and was picking through the trash

Business Model for Purpose and Organizational Goal - myassignmenthelp

Question: Write about theBusiness Model for Purpose and Organizational Goal. Answer: Business model can be defined as the conceptual structure that helps the organization to achieve its mission, purpose and organizational goal. Business models are designed in order to create the value and distribute it in a profitable way. The business models acts in between the two poles of classification and taxonomy (Baden-Fuller Morgan, 2010). Zott and Amit oppose the idea of a general business model, as each business works in a very different individual way. The business models classificatory function depends on the scale models and short-hand definitions (Zott Amit, 2010). In an effective business model the role model and scale model come together and the internet based Google business model is one such example. The concept of business model is getting huge attention because of the internet revolution. Many scholars use the term in order to define as how the internet transformed the traditional business models (Laudon Traver, 2013). The emergence of e-commerce has motivated the scholars and business professionals examine the business models of their organizations. Figure: Business Model Formation ( Source: Made by author) A coherent framework is achieved through the business model which helps the organization to gain financial output. Therefore business model can be described as an abstract model that connects business processes and strategies. Organizations often confuse business model with revenue model (DaSilva Trkman, 2014). Revenue model is a part of the business model which only describes the volume of the revenue, its sources and distribution. Carl Jung developed the idea of business model archetype. He describes archetypes is something which possess certain qualities that others follow and inherit to develop their own. There are business models with fundamental business qualities that provides others good structural base for effective business (Zott, Amit, 2010). The electronic communication has changed the business model significantly. The information technology is at the core of e commerce. Before the emergence of e-commerce the organizations could not maintain close relationship with suppliers as the system was stand alone and high cost based. The e commerce technologies provided huge capabilities to the companies with connectivity, interactivity, openness and transparency which led the company in direct exchange of information among organizations (Barney Ray, 2015). The supplier integration resulted in customer satisfaction and influenced the business model overall. Many enterprises utilized the e commerce opportunity to develop new business models. Through innovate new business models the companies put substantial efforts in generate high revenue. The new business model helps them to improve the product and service quality; however the innovation of new business model requires ample time, research and huge investment. A survey by EIU or Economist Intelligence unit highlights that Majority of the companies now prefer innovative business models over new service or products (Bashir Verma, 2017). They believe that the new model is more effective than the others to give the company more competitive advantages. Another survey by IBM also demonstrated that the companies that went ahead in the competitive race than their competitors in last few years had concentrated more on developing their business models. The business model has four aspects of customer segment, management infrastructure, value proposition and financial aspects. There are other nine aspects that are interlinked with the four mention aspects that contribute to the structure of business model. Few of the important blocks can be identified as revenue streams, key activities and resources and customer relationships. Adapting anew value network model could be helpful to renovate the business model of the company (Stabell Fjeldstad, 1998). The company who has been adapting a new business model at an early stage utilizes the First mover advantages (Markide Sosa, 2013). The late adapters will create competitive resistance for the other company but the adapted business model will help them to overcome that and gain advantage of better sustainability as a first mover. According to Porter the two most adapted strategies to deal with the low cost competitors challenges are differentiation based business model and focus based business model. The differentiation based business model puts a lot of stress on new technologies to fulfill the customers growing need. By adapting the latest technology this business model helps them to connect with other businesses and customers all over the world. This way differentiation based business model helps them to gain the consumer surplus or the maximum value (Williamson, 2010). Focus based business model on the other hand only focuses on a specific niche market. This model practices a safe financial practice where interested customers pay premium value. However cost innovation has become a threat for both these business models. The competitors are offering high technological services at a low price and others are providing niche products to mass market. Larry Page and Sergey Brin founded search engine has grown to be more than just search engine that also deals with desktop applications, social networking, operating system mobiles, and other online services (Google.com, 2017). Goggle is a successful business model which generates billions every year. Googles business model is very creative and effective in a sense that the every customers various needs satisfied by various services of Google. There are niche customers who pay premium cost for special services like advanced mail service, cloud services and Google earth features. On the other hand Google offers lot of free services to its customers including search engine, map that holds a stable customer base for the company. A lot of advertisements are offered by the company to diverse range of customers so business partners invest on the company to attract more customers. Goggle gets in agreement with the mobile OEMs to let the customers downloading their apps. Then the company is also engaging in a lot of offline activities like smart glasses to humanoid robots. Google is a company primarily based on advanced technology. Everyday that is incorporating newer technologies to improve their business model. In a way the polyhedral business model of goggle is working with great success (Retolaza, San-Jose Ruz-Roquei, 2016). Therefore the value propositions practiced by the company are two types. Googles one value proposition is for webmasters who can monetize their services and earn money from the Google provided platform like Ad sense. The other value proposition is for the direct advertisers. Goggles business model has pioneered in successfully interpreting big data in every day practice. The company utilizes the big data from Webindex to equal the queries with desired results (Zicari, 2014). Their monetized platform working on capturing the data from the consumers as they use the search engine. Googles data driven business model in this way is ensuring maximum profit for the company. Various business models have been adapted by many companies; some of them are implementing innovative strategies in the business models. Most of them are well planned and executed and offering great outcomes. The changes in the technology have driven the changes in the models so more technological advancements will keep transforming the business models in future. Reference Baden-Fuller, C., Morgan, M. S. (2010). Business models as models.Long range planning,43(2), 156-171. Barney, J. Ray, Gautam. (2015). How information technology resources can provide a competitive advantage in customer service.Planning for Information Systems,3(2), pp.444-460. Bashir, M., Verma, R. (2017). Why Business Model Innovation Is the New Competitive Advantage.IUP Journal of Business Strategy,14(1), 7. Coleman, A. (2016).Is Google's model of the creative workplace the future of the office?.the Guardian. Retrieved 27 August 2017, from https://www.theguardian.com/careers/2016/feb/11/is-googles-model-of-the-creative-workplace-the-future-of-the-office DaSilva, C. M., Trkman, P. (2014). Business model: what it is and what it is not.Long range planning,47(6), 379-389. Laudon, K. C., Traver, C. G. (2013).E-commerce. Pearson. Markides, C., Sosa, L. (2013). Pioneering and first mover advantages: the importance of business models.Long Range Planning,46(4), 325-334. Our Products | Google. (2017).Google.com. Retrieved 27 August 2017, from https://www.google.com/intl/en/about/products/ Retolaza, J. L., San-Jose, L., Ruz-Roquei, M. (2016). Polyhedral Model: Social Value Model for Stakeholders. InSocial Accounting for Sustainability(pp. 37-51). Springer International Publishing. Stabell, C. B., Fjeldstad, . D. (1998). Configuring value for competitive advantage: on chains, shops, and networks.Strategic management journal, 413-437. Williamson, P. J. (2010). Cost innovation: preparing for a value-for-moneyrevolution.Long Range Planning,43(2), 343-353. Zicari, R. V. (2014). Big data: Challenges and opportunities.Big data computing,564. Zott, C., Amit, R. (2010). Business model design: an activity system perspective.Long range planning,43(2), 216-226.

Book Reflection on Holes free essay sample

The book Holes is about Stanley Yelnats. Stanley’s family has a curse brought by his grandfather Elya Yelnats. Elya made a deal with a gypsy named Madame Zeroni. He wanted the fattest pig so he could get a girl to marry him. So he went to Madame Zeroni and she told him to take the pig up the mountain every day and make him drink water from the river, and when the pig gets fat he has to take her to the top of the mountain and let her drink from the river. He forgot to repay her and she had told him that if he forgot to repay her he and his family would be cursed for all eternity until they repay her. From then on his family was cursed with bad luck. One Hundred Years later Stanley is accused of stealing a pair of cleats donated to an orphanage by a famous baseball player. We will write a custom essay sample on Book Reflection on Holes or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Stanley was given a choice by a judge to go to jail or go to Camp Green Lake. Stanley picked Camp Green Lake. Camp Green Lake is a boy’s juvenile detention center. Although he was wrongly convicted of his crime he was sentenced to a year and a half to Camp green Lake. By the order of the Warden and her assistants Mr. Sir and Mr. Pendanski each inmate in Camp Green Lake has to dig a 5-foot hole every day to build character. Stanley had no friends when he first got there. He slowly developed a friendship with a boy named zero. Everyone at the camp calls him zero because he never talks and he doesn’t know how to read. Stanley teaches him how to read then they become friends. And zero helps Stanley dig his holes. One day zero and Stanley dug up a hole and found something and gave it to Mr. Sir and he gave it to the Warden. It was an artifact from the famous â€Å"Kissing’ Kate† Barlow. The Warden forces them to dig more, she wants to find the treasure that was buried by Murderer Kate Barlow. Stanley and zero find out about the wardens ideas. zero and Stanley know where the treasure is at. So Stanley and Zero run away from the camp. In camp green lake it has never rained in a hundred years so they are walking around in the hot dessert. They go up a mountain and Zero gets Stanley Carries him up the mountain. When they get up the mountain Stanley found water and gives it to Zero. But Stanley never knew that Zero was related to Madame Zeroni. Since Stanley carried Zero up the mountain and gave him water the curse was lifted and his family no longer had a curse. They went back and dug up the treasure and he police went to the camp and arrested the Warden and her assistants. The treasure had Stanley’s name on it so it was his and he gave Zero half of the money and they both stayed friends. An important quote from the book is that â€Å"there is no lake at Camp Green Lake. There was once a very large lake here, the largest lake in Texas. It s important because there used to be a lake but it dried out. Another quote is â€Å"if you take a bad boy and make him dig a hole every day in the hot sun, it will turn him into a good boy. It is an important quote because they made them dig to find the treasure not to make them into good boys. Also when Mr. Pendanski tells Stanley â€Å"You know why his name is Zero, because there’s nothing in his head. † This quote is important because that why Stanley teaches him how to read. These are some quotes that have a significant meaning to the book. Reading holes shows that you can’t judge someone without knowing that person. We can learn to stop being hasty every time we judge someone. Because we can make huge mistakes. Like Stanley did with Zero. At first he underestimated Zero, probably because of the influence the other kids had on him. He thought Zero was stupid, even though he didn’t know him. Everyone thought he was brainless, but he just didn’t like answering their questions. â€Å"You know why his name’s Zero? † Mr. Pendanski â€Å"Because there’s nothing inside his head. † Mr. Pendanski â€Å"Even you, Zero. You’re not completely worthless. † Mr. Pendanski Every time Stanley wrote a letter to his mother, Zero was always watching behind his back. That annoyed Stanley because he thought Zero was reading everything he wrote. The thing was that Zero didn’t know how to read. â€Å"He didn’t care what Zero thought. Zero was nobody. † Zero asked Stanley if he could teach him how to read, but Stanley refused. He didn’t have the strength to try to teach Zero to read and write. This is what I learned from reading this book.

William Gladstone essays

William Gladstone essays A sophisticated rhetorician, inebriated with the exuberance of his own verbosity, and gifted with an egotistical imagination that can at all times command an interminable and inconsistent series of arguments to malign an opponent and to glorify himself, once said by Benjamin Disraeli, a former Prime Minister of England and competitor of William Gladstone for the position. He also stated ,He has not one single redeeming defect. William Gladstone was a very successful and caring man. This was shown through his work and family life. On May 19th, 1898 Gladstone died at Hawarden. He was then buried in Westminster Abbey. William Ewart Gladstone was son of John Gladstone a very wealthy man. John Gladstones1828 fortune would be worth a modern 25 million pounds. He had gotten this from his early Liverpool days when he was primarily a corn trader that brought him to the Mersey the skill which he had developed in Leith, and he also made mostly Baltic purchases. He then became a partner of the East Indian house, which dealt with mainly subcontinents, and coming up against the restrictive privilege of the East India Company. In 1843 he turned himself from a merchant adventurer into a rentier. The West Indies stake was down and his shareholdings were up. Sugar was the core of his West Indies activities, but tobacco and cotton were also important. He did not trade in slaves, even before the slave trade was outlawed in Britain in 1807. However, The plantations he operated were under slave labour throughout his time as a West Indian magnate. In 1818 John then became a member of Parliament. His career in Parliament never prospered due to starting at the age of fifty-four. He also had to buy his favors, and failed to make neat William Ewart Gladstone was born in Liverpool on December 29th, 1809 and was the forth son of Sir John Gladstone and his second wife ...

EasyJet A No Frills Airline Assignment Example | Topics and Well Written Essays - 2000 words - 1

EasyJet A No Frills Airline - Assignment Example The disadvantages of the cost leadership strategy, as employed by EasyJet, include negative perceptions of quality, poor customer service, and unsustainable discounting systems. It is recommended that EasyJet adopt highly flexible strategic decisions, develop a more aggressive and direct strategy, and reevaluate its wage structure. Finally, it will provide a comprehensive conclusion, and make the necessary recommendations regarding the subject. This paper provides a comprehensive perspective of EasyJet as a company, including the cost leadership approach, which is the generic strategy favoured by the company. EasyJet is a leading budget airline that operates mainly in Britain and Southern Europe. The company’s headquarters are in Luton, Britain. According to Anderson (2014:41), as at December 2014, EasyJet employed almost 9,000 people and flew to over 600 destinations in 30 countries. In the financial year ended September 2014, the company posted revenues of  £4,527 million (Anderson, 2014:41). This represents a 6.3% growth in the 2013 financial year. Pre-tax profit, on the other hand, was  £581 million, representing a 21.5% increase in 2013. EasyJet’s 2014 financial results were positive to say the least, and reflected the strategic decisions made by the company to maximise efficiency and expand its services to more countries (Chen, 2013:34). The strategic plan implemented in 2013 was necessitated by changes in the global and European airline industries that complicated operating conditions for most airlines. EasyJet, however, has been able to not only adapt but also t o perform in spite of the conditions. As of December 2014, the company’s founder, Sir Stelios Haji-Ioannou, is the largest shareholder (Doganis, 2013:38). Apart from basic travel, EasyJet offers a range of auxiliary services. For example, it collaborates with Gate Gourmet for its in-flight products and services, Europcar, for car hire services, and booking.com that

Australian Security in the 21st Century Essay Example | Topics and Well Written Essays - 2000 words

Australian Security in the 21st Century - Essay Example in East Asia must not only be capable of deterring a North Korean attack or a Chinese lunge across the Taiwan Strait, they must support the war on Islamic fundamentalist terror in Southeast and South Asia".2 In addition, China's role as a major world power, and its welcomed economic contribution, needs to be balanced against its military ambitions and intentions. Realist theorists have postulated the possibility that "the accompanying relative loss of power of the USA, and the possible decline in the importance of European nation states will lead to a renaissance in the power rivalries of great actors and possibly even to violent conflicts".3 All of these issues require a great deal of international cooperation and a series of evolving multilateral agreements. The need for a multilateral security umbrella for Asia, Australia, and the US has been hindered by history, tradition, and the current political and economic climate. Currently, most security concerns are constructed as bilateral agreements between the US and the interested country. Historically, the US has acted as a hub with a number of bilateral spokes, whose participation comes about through their interaction with the US. The history of Australia and Japan still lingers from the remnants of World War II and had created some issues of trust and cooperation. According Jain, "Until the end of the Cold War in the early 1990s, most links between Australia and Japan that concerned national security were largely indirect (via the United States, through the US/Japan Security Treaty and the ANZUS alliance)".4 In addition, Australia receives a tepid welcome from ASEAN where it remains isolated as a dialogue member. The North Korean threat has been made more difficult by the popularity of t he Korean unification agenda... Australian Security in the 21st Century Its European ties and Western culture operates in the shadow of China's economic influence and the US hegemonic military might. Asia needs the defence force of the US, but has numerous internal and external tensions that make multilateral security agreements temporary and tenuous at best. As we move into the 21st century, the US will continue to provide a significant security presence in Asia, while Australia, faced with a rapidly changing political and economic landscape, will need to rely on an ever-changing series of ad-hoc multilateral security arrangements. The end of the Cold War finalized the polarized concept of two super powers with strict allegiances across the globe, and ushered in a new wave of security concerns that demand multilateralism. While the US is currently perceived as a hegemonic power, the nature of a global national security has diluted the resources of the US with their wars in Iraq and Afghanistan. The new threats to Asian security are terrorism, nuclear proliferation and the Korean issue, drug smuggling, piracy on the seas, illegal movement of immigrants and populations, and the looming threats of the ambitions of India and China. No nation in the region can afford to create hostilities with China, and the concerns of North Korea and Taiwan must be handed with diplomatic care and steadfast commitment. Australia, led by the US military, will continue to court China as it is drawn into the Asian Community.

The Great Gatsby Essay Example for Free

The Great Gatsby Essay The Great Gatsby, written by F. Scott Fitzgerald, introduces the reader to scenes of violence that contribute to the meaning of the complete work. Wealthy, powerful characters such as Tom Buchanan are the major causes of violence introduced because they are selfish and careless. Through an accident that killed Myrtle Wilson, or the passionate murder of an innocent man, Fitzgerald incorporates themes of the novel. The violent act that begins the downward spiral in The Great Gatsby is when Tom Buchanan hits Myrtle, his mistress, in the face. It was a body capable of enormous leverage — a cruel body (Fitzgerald, 12). † is how Nick describes Tom’s intimidating physique when he first meets him. So it is not surprising that when Myrtle begins to taunt him by repeating his wife’s name that he reacted and â€Å"broke her nose with his open hand (Fitzgerald, 41). † This scene of violence demonstrates that people like Tom, living in East Egg, think that they are better than everyone else and can disrespect or ignore others because of social status. This is the underlying cause of the deaths in the novel. One of the most tragic scenes of violence occur when Daisy Buchanan is driving in the car with Gatsby, returning home from their dramatic visit to the city with her husband. She is hysterical because Tom revealed that Gatsby is a bootlegger. While passing through the Valley of Ashes, Myrtle runs out to the car because her husband is forcing her to move and she needs help. â€Å"The ‘death car,’ as the newspapers called it, didn’t stop; it came out of the gathering darkness, wavered tragically for a moment and then disappeared around the next bend (Fitzgerald 144). is how the killing is described. As a result of Daisy’s recklessness, she brutally ran over Myrtle Wilson. Besides the fact that Myrtle was murdered, the importance of this scene is that Daisy did not even stop to take a look at the damage her state had caused. Her ignorance ultimately was the cause of Gatsby’s death. Fitzgerald purposely included wealthy, irresponsible characters in his novel that caused the violence and completed story. To sum up the importance of the crowd with â€Å"old money†, this is a quote from when Nick is speaking to rejected Gatsby. He says, â€Å"They were careless people, Tom and Daisy- they smashed up things and creatures and then retreated back into their money or their vast carelessness or whatever it was that kept them together, and let other people clean up the mess they had made. (Fitzgerald, 188)† It is clear that all they cared about was themselves, and after the murders occurred, they left town and did not attend one funeral. The last act of violence, when Gatsby is murdered, leaves an important impression on the reader and the novel. George Wilson is devastated by his wife’s death and thinks that God wants him to kill the person who is responsible for it. Naturally, he went to the Buchanan’s to get some answers because it was their car. Tom was in a fragile state because he truly loved Myrtle, and directed George to Gatsby. Gatsby did not kill anybody but he paid the price for it. He was laying in his extravagant pool and saw â€Å"that ashen, fantastic figure gliding toward him through the amorphous trees (Fitzgerald, 172). † First George shot Gatsby, then he shot himself and ended two innocent lives. It was because Gatsby constantly chased one single dream his whole life that the scene of violence had to happen. Daisy was not good for him, and dreams keep getting pushed farther and farther away from people because the past is haunting and unchangeable. The violent scenes Fitzgerald included in The Great Gatsby are the altering moments that support the underlying themes of the past, society and class, and love. Tom’s powerful nature, cheating on his wife, and violence represent the danger and authority. Fitzgerald made a point to include careless, wealthy characters in the novel that contributed to completing the violence and work as a whole.

Historical Account of African-Americans Seeking the American Dream Essa

Historical Account of African-Americans Seeking the American Dream The American Dream began as a vision for the men who framed the Declaration of Independence and the Constitution of the United States of America. These two documents provided the foundation upon which the American Dream was built. The reality of the American Dream translated into a nightmare for the African-Americans who had to overcome slavery in order to achieve the ideal that all men are created equally. Their dream did not become a reality with the signing of the Declaration of Independence; in fact, even after slavery was abolished, there was no concrete date established that mandated that whites and African-Americans were equal. The law said the slaves were free; however, society did not consider them equals. The African-American writers utilize the American Dream in their works, but they seem to use it in an interesting manner: connecting to the past in order to realize their future. The slave narratives outline dreams of freedom and often provide insight into the horrors of s lavery, while more contemporary writers use the dream to connect to their characters’ past and the horrors in their lives in order to realize their future. The founding fathers of the United States of America crystalized this country with a "dream". Their dream was a vision of the things they wanted in life and for their country, which was memorialized in the form of the Declaration of Independence. The architects that built this country dreamed that all men would be considered equals and "that they are endowed by their Creator with certain inalienable rights" including "life, liberty, and the pursuit of happiness" (Jefferson, 729). The original version of this dream, found in ... ...ument, which made this declaration. The American Dream is a real part of our culture and the dream seems to be a strong theme in the African-American literary canon. Works Cited Bradley, David. The Chaneysville Incident. New York: Harper & Row, 1981. Brent, Linda. Incidents in the Life of a Slave Girl. The Classic Slave Narratives. Ed. Henry Louis Gates, Jr. New York: Penguin Group, 1987. Douglass, Frederick. Narrative of the Life of Frederick Douglass. The Classic Slave Narratives. Ed. Henry Louis Gates, Jr. New York: Penguin Group, 1987. Equiano, Olaudah. The Life of Olaudah Equiano. The Classic Slave Narratives. Ed. Henry Louis Gates, Jr. New York: Penguin Group, 1987. King, Jr., Martin Luther. "I Have a Dream." Lincoln Memorial, Washington, D.C. 28 August 1963. Morrison, Toni. Song of Solomon. New York: The Penguin Group, 1977.

Potato Osmolarity Lab Essay

Purpose: The purpose of the lab is to discover the osmolarity of the potato tissue. Background Information: Osmolarity is a concept similar to concentration, except it is the total number of solute particles per liter. In this lab we can show osmolarity by using sucrose solutions and potato ores. This experiment displays hypertonic, hypotonic and isotonic solutions. A hypertonic solution is a solution with a relatively higher concentration, hypotonic cis relatively lower, and isotonic is the same. Variables: Constant = size of potato core Independent = sucrose molarity Dependent = mass percentage change Safety: Follow lab safety protocol and be careful with cork borer. Procedure: 1. With a cork borer, cut six cores from a potato. The cores should all be as close to the same length as possible: 30-50 mm cores are recommended. 2. Before continuing, produce a table that will show the volume and mass of the potato cores before and after being placed in solutions of 6 different sucrose molarities. 3. Determine mass of potato cores using a laboratory balance. Record in table. 4. Place each core in a different test tube labelled with the core’s identification letter and the molarity of the sucrose solution to be placed in the tube 5. Add a labelled molar solution to each test tube until core is covered. Place foil over each tube and store for 24 hours 6. On the next day, repeat step 3 Conclusion/Analysis: The osmolarity of the potato core is 0.4 M, I determined this by finding where on my graph the percentage change in mass was equivalent to 0. This meant that there was no change in mass, the tissue and solution were isotonic, and the molarity of the solution is the same as the osmolarity of the tissue. In this lab, and all experiments, an accurate measurement of mass was crucial to finding the correct results, trend, and osmolarity. The conclusion of this lab was based off of a negative trend on the graph which could have been skewed from inaccurate data. In order to attain more reliable data I could have done multiple trials in the procedure which would clarify my results and conclusions. Also to generate better data a more precise device for measuring the mass of the potato cores could have been used. Also the size of the potato cores could have been more constant to create more accurate data. Outside of this experiment osmolarity is used in urine tests to calculate the concentration of certain particles in urine. An osmolality test can also be used for the blood to see the number of solutes present. These tests are then helpful in diagnosing and treating patients.

An Interdisciplinary Unit On The Civil War Themed - 872 Words

To showcase my proficiency with middle level curriculum, instruction, and assessment, I have selected an interdisciplinary unit on the Civil War themed â€Å"Preserving the Past†, a Discipline Literacy and Instructional Planning project about North Carolina geography, and a collaborative Greek Mythology unit I taught during student teaching. In all three of these artifacts, I have developed relevant, integrative, challenging, and exploratory units of study. The â€Å"Preserving the Past† unit incorporates all four core subjects as well as a service learning opportunity. My interdisciplinary unit on geography connects Language Arts with Social Studies with visual art mixed in, and the Greek mythology ELA unit was taught in conjunction with a Social Studies class (1). The Civil War unit and NC geography unit I have created incorporate Common Core standards as well as NC Essential standards. Lesson plans and assessments in all of these units were created using backwards design in which I started by looking at the standards and objectives students would be expected to reach and based my assessment based on those objectives (2,10). The â€Å"Preserving the Past† unit was created in collaboration with two other colleagues. We all created the Social Studies lesson plans, and each person was responsible for one of the other core subjects. This project required collaboration in order to create an authentically interdisciplinary unit. The service-learning opportunity requires students to think