Gender Representation Essay

How cliché are the portrayals of Gender in my picked messages? My picked writings are ‘The Inbetweeners’ , ‘X Factor’ and ‘BBC News’. Each of the three writings speak to sex in various manners yet I wouldnt state that any of them genuinely speak to the two sexual orientations in cliché ways. In ‘The Inbetweeners’ the primary characters are depicted in a cliché route from the outset, they are boystrous and externalize ladies in the rough manner by which they talk about them. However when you look further into their characters you understand that they are not run of the mill by any means. The females in the show are run of the mill it might be said that they are entirely, sharp looking and are simply there for the â€Å"male gaze.† It is this male look that eventually makes them more impressive than the guys in the arrangement as they have the ability to either lay down with, or not lay down with the guys which removes all control from the men which is definitely not a common characteristic. At the point when you think about a run of the mill male in television they are solid, attractive and in charge, this isn't generally clear in ‘The Inbetweeners’ which underpins the manliness in emergency hypothesis which expresses that guys are not, at this point the prevailing sex in current society. Ladies might be externalized still yet they utilize their sex request to there advantage and get their own particular manner leaving the guys feeble. You do how ever have the regular character of Jays father which is a hyperbolic case of a male as he passes gas, swears and acts in a totally innaproriate path for the comedic esteem. The ‘X Factor’ has an exceptionally differentiating portrayal of sexual orientation. In one manner the male characters are cliché as they have the ability to state yes or no to the goes about as judges. Guys are characteristically known for being in a place of intensity so this is an ordinary portrayal. However you have Dermot O’leary who is extremely manly in his appearance yet is exceptionally thinking about the challengers. This isn't common as guys arent normally appeared to have a mindful side or feelings as that is left for the ladies. This again bolsters the hypothesis of manliness in emergency. The Female Judges don't have an extremely run of the mill portrayal. They are in a place of power and power and to a degree in the new arrangement do have more force than the male appointed authorities as they are increasingly commanding and show signs of improvement. This isn't commonly the manner in which ladies are spoken to fitting into the hypothesis of Masculinity in emergency. The BBC news is a lot of like the ‘X Factor’. At the point when the guys are the stays they are in a place of intensity and information which is a normal portrayal. They appear to the country as a mainstay of information and the open give them a tremendous measure of regard which is normal of the portrayal of men. At the point when the ladies are grapples they also are viewed as a mainstay of information and are given a similar regard which doesn't fit into the run of the mill portrayal of a female.

No Such Thing - John Mayer Song free essay sample

John Mayer rouses individuals who don’t have it in the same class as a portion of the individuals around them to take a gander at things in an unexpected way. He conveys a message saying that its alright to appear as something else and not every person will wind up as effective as each other. It is significant not to contrast yourself with any other person and not feel that you need to satisfy what individuals need u to. Things you do ought to be done in light of the fact that you need it, and not to fulfill another person. There are numerous things out in the â€Å"real world†. Something there to fulfill everybody, except you need to go out and search for things, they won't discover you. Things happen to individuals at various occasions, and you should feel frustrated about yourself, or terrible about yourself since it may appear that they have it superior to you. Simply tuning in to John Mayer, particularly â€Å"No Such Thing† he is marvelous. We will compose a custom article test on Nothing of the sort John Mayer Song or on the other hand any comparative theme explicitly for you Don't WasteYour Time Recruit WRITER Just 13.90/page John Mayer is another stone craftsman. He is a lyricist and vocalist. He is an invigorating change from most popular music heard today. John Mayer sings about how he feels, where as other craftsman sing what the person feels the individuals need to feel, thus, it doesn't seem like it is originating from the heart. John has a pleasant acoustic tune and sings awesome music that state, from multiple points of view, â€Å"Ill show them†. The verses in his melodies are so important. I like the verses to â€Å"No Such Thing† by John Mayer so much since I can identify with him to such an extent. At the point when Mayer sings â€Å"They need to let you know, remain inside the lines yet a few things better on the other side†, he is stating that individuals should take risks. It implies that you don’t consistently need to make the best decision and you ought to go out into this present reality, open up to new chances, and face reality

Essay Samples For BSN

Essay Samples For BSNGetting the right essay samples for BSN can be a challenge. In fact, sometimes we end up getting too many and it feels like we are wasting our time trying to find the right one. Well, you shouldn't have this problem.Having to write an essay in order to get into a BSN program can be overwhelming. So many things need to go right and unfortunately for some, the writing has to go wrong in order for them to achieve this. If you happen to find yourself in this position, try looking for essay samples for BSN. They will help you along the way.One of the best ways to get essay samples for BSN is to look for them in your classes. Most professors require this in their students and if not, they will likely have the class read it to them so that they can correct any mistakes. You may even be able to get this in your classes without your professor reading it. This is another reason why you should write a rough draft first before sending it in.Another thing you can do to get es say samples for BSN is to ask for them. Your professor or other students in your class could have written them and it would be great to see them all together instead of just one copy.You may also find essay samples for BSN online. There are websites that have different types of essays for different situations. Some of them may be difficult to understand and not as readable as others. The good thing about these is that they may give you something to practice on if you find your essay to be a little difficult.There are some free sites online that will offer you essay samples for BSN. This is especially helpful when it comes to essay writing because they are free. While you won't be able to get any helpful information from them, it will allow you to write your own essays and maybe start fresh.In conclusion, it will take you a while to find essay samples for BSN. You should make sure you check online for a number of essays before you submit yours. You should also find a few places to ge t sample essays in your class so that you can practice with them.Don't worry if you cannot find any essay samples for BSN. Just keep trying until you find one that you can write well.

Cloning and Expressing of Aryl Alcohol Oxidase - Free Essay Example

Sample details Pages: 3 Words: 862 Downloads: 6 Date added: 2019/08/08 Category Science Essay Level High school Tags: Cloning Essay Did you like this example? Abstract: Cellulose fuel ethanol does great significance on solving the energy crisis and reducing environment pollution. However, in the process of industrially degrading cellulose into ethanol, it is difficult to directly degrade the cellulose because of the presence of the lignin barrier. While the aryl alcohol oxidase is responsible for providing H2O2 to initiate the enzymatic reaction of lignin peroxiadase and manganese peroxidase in the lignin degradation system of white rot fungi. Don’t waste time! Our writers will create an original "Cloning and Expressing of Aryl Alcohol Oxidase" essay for you Create order In this study, we obtained the cDNA of aryl alcohol oxidase by obtaining the white fungi RNA and then carrying out reverse transcription method, and transforming it into Pichia pastoris for heterologous expression to collect aryl alcohol oxidase. Subsequent purification was performed for further use. Key Words: white rot fungi; aryl alcohol oxidase; Pichia pastoris Introduction Because of the decreasing of oil production and Greenhouse Effect, people turn to new energy while one of them is cellulose fuel ethanol. [1][2] However, several challenges occur during the catalytic process from cellulose to alcohol. One of the challenges is what we call â€Å"lignin barrier†, which is a network around the cellulose composed of lignin and hemicellulose by covalent bond.[3] The existence of lignin barrier will hinder the contact between cellulose and its catalyst. Meanwhile, an enzyme system from white rot fungi which can degrade the lignin barrier efficiently has been reported.[3] This enzyme system contains several enzymes like laccase(Lac), manganese peroxidase(MnP), lignin peroxidase(LiP), aryl alcohol oxidase(AAO), etc.[3][4] The function of AAO is to provide H2O2 to start the reaction catalyzed by MnP or LiP.[5][6] One characteristic of AAO is that is can oxidize alcohol to aldehyde.[7] In our study, we cloned the gene of AAO and transformed it into Pich ia pastoris which is suitable host to express exogenous gene. Then we cultivate the yeast and detect the enzymatic activity every day. When the enzymatic activity peaked, we separated AAO from formented liquid and purified it by dialysis and anion exchange resin. We then calculated the output and enzymatic activity of our AAO and compared it with the nature one to find that whether the expression and enzymatic activity of exogenous AAO gene is remarkable to be used in industry or not. Results Obtain the AAO Gene Fig.1 Blast analysis of AAO gene we obtained. The first one is hypothesis so it is excluded. The second one is AAO gene and the similarity between is 98%. By inverse transcription and polymerase chain reaction (PCR) we can get the sequence of AAO. We can draw the conclusion the we successfully obtained the AAO genes using Blast analysis (Fig.1). Analysis of AAO cds Fig.2 Amino acid sequence of AAO cds.. Using Expasy to translate our AAO cds we can draw the amino acid sequence of AAO. Message we can gain from the amino acid sequence is that AAO is composed of 593 amino acids and its molecular weight is 63683.40. By analyzing its amino acid sequence we can learn more about its spatial structure and how it works. Enzymatic Activity Material and Methods Obtain the AAO Gene First, we had used the Trizol method to obtain all the RNA of Pleurotus ostreatus BP3, one kind of white rot fungi. The we degraded it by applying RNase and obtained the AAO RNA sequence by electrophoresis. After that the AAO DNA sequence was obtained by inverse transcription and was amplified by PCR. Formulation and Transformation of the Plasmid Carrier Fig.2 Anticipated formulation of plasmid carrier. AOX1 promoter only can be activated by methyl alcohol so we can control the start of AAO expression. CYC1 terminator is used to stop the expression. Before and after AAO sequence there are two restriction sites for EcoR 1 and Xba 1. We use pPICZ?A plasmid for our formulation. First, we use EcoR 1 and Xba 1 for a double-restriction on the plasmid. Then we can ligate AAO DNA sequence to both ends by a Vazyme kit during PCR. [8] The primer is designed as: HAAO-F? AGAGAGGCTGAAGCTGAATTCAACCTCCCAACCGCTGATTTTGATTA HAAO-R? GAGATGAGTTTTTGTTCTAGACTACTGATCAGCCTTAATAAGATCGGC After that the pPICZ?A-AAO plasmid was transformed into Pichia pastoris and was expressed as exogenous gene. Detection of Enzymatic Activity The enzymatic activity was calculated according to a reaction catalyzed by AAO from mannitol to mannuronate. The latter owns a absorption peak at 330 nm.[9] The absorption of this reaction system at 330nm is monitored by an ELIASA and according to its variation we can get a slope. The enzymatic activity should be inferred by this equation[9]: enzymatic activity?U/L?=(slopeÃâ€"10^6 Ãâ€"0.2 )/(9300 Ãâ€"0.625 Ãâ€"0.01 ) In this equation, 0.2 stands for the volume of reaction system (0.2ml), 9300 equals 9300M-1cm-1?, 0.625 means the optical path is 0.625cm and 0.01 is the volume of liquid which is used for ELIASA to detect. Discussion and Conclusion From the final enzymatic activity we can draw the conclusion that the output and enzymatic activity of exogenous AAO gene is similar to/better than nature white rot fungi.[10] For this reason, we can deem that our idea to express AAO in Pichia pastoris is feasible to be apply to industry in order to degrade the lignin barrier. That will directly lead to the progression of efficient to catalyze cellulose to alcohol. Acknowledgements This study is supported by my tutor Dr.Wang and my senior Miss.Gong.

Bulimia and Depression Essay - 2364 Words

Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimia†¦show more content†¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words   |  5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words   |  5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words   |  4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words   |  6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly â€Å"low in calories†. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words   |  6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ‘serious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words   |  5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a persons’ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words   |  4 Pagespaper to examine how the events of Diana’s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Today’s World are Affected by Society’s Projection of Self-image670 Words   |  3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words   |  5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people don’t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words   |  5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than

Bulimia and Depression Essay - 2364 Words

Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimia†¦show more content†¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words   |  5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words   |  5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words   |  4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words   |  6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly â€Å"low in calories†. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words   |  6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ‘serious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words   |  5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a persons’ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words   |  4 Pagespaper to examine how the events of Diana’s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Today’s World are Affected by Society’s Projection of Self-image670 Words   |  3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words   |  5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people don’t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words   |  5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than

Bulimia and Depression Essay - 2364 Words

Bulimia and Depression The prevalence of eating disorders among American women has increased dramatically in the past decade. In turn, the psychological community has expanded its scope of research and study by focusing more attention on eating disorders and concentrating on other extended issues related to eating disorders. The desire to distinguish and understand a possible relationship between bulimia nervosa and depression has become a major focus within the field. The purpose of this paper is to introduce the reader to literature from two different journal articles on this relationship. How Are Bulimia and Depression Possibly Related?: Presently, there are two predominant hypotheses on the relationship between bulimia†¦show more content†¦Cognitions manifested by bulimics include dysfunctional attributions regarding weight gain, guilt, and self-deprecating attributions centered on feeling out of control. Schlesier, et al. (1987) state that depression: ...carries characteristic cognitive features of clinical import. Maladaptive thinking patterns related to depressive symptomatology include negative automatic thoughts, dysfunctional attitudes, and causal attributions. Therefore, there are connections between these two disorders. There is a link in the relationship between bulimia and depression. Understanding this link is essential for treatment and therapy. Article I - Bulimia and Depression: A Review of the Affective Hypothesis: Lisa Hinz and Donald Williamson (1987) reflect on the evidence presented in past studies relating bulimia and depression and discriminate between the idea that bulimia is an affective variant of depression or a separate diagnostic entity often associated with depression. In their attempt to understand the relationship, the authors point out the complications that arise in an evaluation of studies that deal with depression and other illnesses due to the common associations made between the two. Hinz and Williamson (1987) state that evaluation of the affective variant hypothesis is difficult because it is well established that depression accompanies many chronic psychiatric and physicalShow MoreRelatedAnorexia Nervosa And Bulimia Nervosa1122 Words   |  5 PagesAnorexia Nervosa and Bulimia Nervosa are a few of the most common disorders struggled with today. Anorexia Nervosa is a condition of the intense fear to gain weight, which results in consistent lack of eating. Bulimia Nervosa, involves frequent episodes of binge eating followed by throwing up because of fear of gaining weight. The mortality rate for anorexia is the highest of all mental disorders yet the genetic factors relating them were not a huge concern to look into. It is easy to think thatRead More Anorexia and Bulimia - A Growing Epidemic Essay1090 Words   |  5 Pages Bulimia and anorexia is a growing epidemic in America. Bulimia and Anorexia can start at any age, but is most common between the ages of 11-17 years old. Of all the individuals that experience this illness only 50% of all of them are ever cured, and another 6% that suffer from this horrible illness will experience death. This illness has become very deadly to our young adults. Bulimia and anorexia can cause a distorted image in a persons mind because they truly believe they are overweight. InRead MoreBulimia Nervosa: The Disease, Diagnosis and Therapy Essay882 Words   |  4 PagesBulimia, known as Bulimia Nervosa, is a deadly eating disorder in which an individual believes they are fat or overweight. Those individuals lose weight through unhealthy and dangerous methods. The overall desire to be thin and accepted appears to be the main cause of Bulimia. The attitudes about diet and appearance expressed by parents can be a factor. Teens may temporarily become slightly overweight and parents who react negatively may cause their children to become fearful or anxious about theRead MoreBulimia Nervos Eating Disorder1271 Words   |  6 Pages Bulimia Nervosa Presenting Problem Bulimia Nervosa, also referred to as Bulimia, or Binge-Purge behavior, is an eating disorder in which an individual will engorge themselves with unusually large amounts of food in a short amount of time and purge later. Between eating binges, a person with Bulimia Nervosa will tend to restrict their caloric intake, and by their own preference select foods in which they believe are seemingly â€Å"low in calories†. Often, an individual may feel out of control duringRead MoreEssay Eating Disorders in Adolescents1302 Words   |  6 PagesEating Disorders in Adolescents The eating disorders anorexia nervosa and bulimia nervosa are complex psychosomatic illnesses. Underlying biological diatheses related to the regulation of mood, hunger, satiety, weight control, and metabolism, combined with psychological and sociocultural vulnerabilities, place an individual at risk for developing an eating disorder (Kaplan and Garfinkel, 1993). The American Anorexia Nervosa Association defines anorexia as a ‘serious illness ofRead MoreEating Disorders : Eating, Bulimia, And Anorexia1215 Words   |  5 PagesThere are many different types of eating disorders such as binge-eating, bulimia, and anorexia. All three eating disorders are very similar, but they are also differ with the issue they cause. Eating disorders can be harmful to a persons’ body because when they keep vomiting, it causes certain parts of the body to deteriorate over time. Each disorder has many symptoms, causes, warning signs, and health problems. All disorders differ with the way they affect people and how the person is treatedRead MoreEssay about Princess Diana : A Case Study834 Words   |  4 Pagespaper to examine how the events of Diana’s life in conjunction with psychological components contributed to her development of bulimia nervosa. Biological Component Eating disorders like bulimia are a significant public health problem for individuals across the lifespan (American Psychological Association, 2012).More important, the biological explanation of bulimia derived from the concept of multiple causality, suggests symptoms of eating disorders are heavily influenced by non-geneticRead MoreTeenagers in Today’s World are Affected by Society’s Projection of Self-image670 Words   |  3 Pagesbegin to experience depression which can ultimately lead to suicide. One of the eating disorders many resort to is bulimia. Bulimia nervosa is the act of binging and purging to compensate weight gain via laxative or self-induced vomiting (www.nationaleatingdisorders.org). Because bulimia is typically practiced with self-induced vomiting, there are many negative effects. These can be anywhere from popped blood vessels in the eyes, to esophageal/bowel rupture and tooth decay. Bulimia affects about oneRead MoreEating Disorders : Deterioration Of The Mind1117 Words   |  5 Pageslives of many poor unsuspecting human beings and in some cases, fatally takes lives. This topic presents many things that most people don’t know. Such as the fact that bulimia nervosa has similar symptoms to using the drug heroin! Rotten teeth, pale and dry skin, and even failing organs are usually signs that someone may have bulimia. There are always key signs and factors to recognizing an eating disorder. Eating disorders are serious. We all should be aware of the affec t it has on an individual,Read MoreEffects Of Anorexia Nervosa And Bulimia Nervosa1150 Words   |  5 Pageseating disorders, the media plays an influential role in the lives of many women. Eating disorders are abnormal and serious disturbances in one s eating habits caused by many factors. Anorexia nervosa and bulimia nervosa are two well-known eating disorders. The causes of anorexia nervosa and bulimia nervosa are difficult to understand but there are a lot of factors that play a role in the development of them. Females are more likely to develop an eating disorder and heightened concern about weight than